все о орехах

Чеснок и вирусы


Вся правда о пользе чеснока при борьбе с вирусами

В условиях пандемии коронавируса многих людей интересует вопрос, может ли чеснок защитить организм от опасной вирусной инфекции, и каким образом осуществляется такая защита.

Уникальные лечебные свойства, продлевающие жизнь человека

Об уникальных лечебных свойствах чеснока знали еще древние лекари, недаром его цветки присутствовали в гербах ряда гильдий европейских и азиатских аптекарей. В современном научном мире, требующем доказательств для утверждений, было проведено не менее 15 тыс. исследований, подтвердивших пользу чеснока в борьбе с тремя главными типами заболеваний, приводящих к смерти человека:

  • онкологии;
  • инфекционным болезням;
  • сердечно-сосудистой патологии.

Несмотря на это, ни один из компонентов этого овоща не был использован при производстве синтетических медицинских препаратов.

Компоненты чеснока, обеспечивающие его лечебные свойства

Всем хорошо известный овощ, активно использующийся в кулинарии, является источником уникальных веществ природного происхождения, имеющих ярко выраженный лечебный эффект:

  • аллицин, обладающий антиоксидантными и антибактериальными свойствами. Именно он не дает распространяться раковым клеткам и инфекционным агентам в организме;
  • сера и кварцетин, усиливающие свойства аллицина. Кварцетин также способствует укреплению стенок сосудов;
  • диаллилдисульфид, обладающий противомикробными свойствами и высокой профилактикой легочной онкологии;
  • селен, предотвращающий развитие инфарктов и инсультов, выступающий в качестве антиоксиданта и средства, предотвращающего рост злокачественной опухоли;
  • триптофан, обеспечивающий выработку организмом серотонина и мелатонина для борьбы со свободными радикалами;
  • эфирные масла и фитонциды, убивающие вирусы в воздухе.

Чеснок не только способен защитить от вирусной инфекции, но и ускорить процесс выздоровления человека, предотвратив появление тяжелых осложнений гриппа, ОРВИ и респираторных заболеваний.

Как чеснок защищает от вирусов

Неслучайно этот пряный овощ называют природным антибиотиком. Чеснок способен уничтожать с помощью своих фитонцидов даже туберкулезную палочку в несколько раз быстрее, чем карболовая кислота.

Ациллин обеспечивает блокировку ферментов вирусов, с помощью которых они проникают в кровь. В желудке он убивает большое количество вирусов и патогенной микрофлоры. Противовирусное и противогрибковое действие чеснока доказано научными исследованиями. Этот овощ имеет мощные противовирусные свойства.
Известно, что большое количество вирусов вызывают осложнения в виде микробных вторичных инфекций, которые быстрее проникают в ослабленный вирусом организм. Употребление сырого чеснока и составов, изготовленных на его основе, позволяет избежать вторичной инфекции и обеспечивает купирование вирусного агента.

Преимущества чеснока при лечении вирусных заболеваний

Известно, что специальных препаратов против вирусов не существует. Использовать синтетические антибиотики для лечения вирусных инфекций нельзя. Употребление чеснока, имеющего официальный статус мощного антибактериального средства природного происхождения с широким спектром действия, становится единственной возможностью защитить ослабленный вирусной инфекций организм от патогенных бактерий и микробов.

Несколько зубчиков чеснока в день станут источником мощнейших антиоксиданотов, противовирусных и антимикробных веществ, большого количества витаминов и микроэлементов, которые помогут запустить механизм естественного выздоровления и усилят иммунитет человека.

Помогает ли чеснок от вирусов — ответы от эксперта

В последнее время многих волнует вопрос, помогает ли чеснок от вирусов. Продолжайте читать статью и узнаете так ли это. Здесь представлено много интересной информации из научных источников, которая будет полезна для вашего здоровья.

Химический состав чеснока

Луковицы чеснока содержат фитонциды, триптофан, серу, кристаллическое вещество аллин, которое под воздействием фермента аллиназы расщепляется на аллицин, пировиноградную кислоту и аммиак. Также. растение содержит эфирное масло, инулин, фитостерины и витамин С.

В зелёных листьях чеснока также содержится витамины группы В, аскорбиновая кислота, витамины РР и Р.

Какими свойствами обладает чеснок

Строители пирамид в Древнем Египте ежедневно ели чеснок, чтобы повысить свою силу и выносливость. Олимпийские спортсмены Древней Греции использовали его как допинг перед началом соревнований. С библейских времён это растение использовалось для лечения различных недомоганий. В наше время наука доказала следующие полезные свойства чеснока:

  • Понижает кровяное давление
  • Расширяет стенки кровеносных сосудов
  • Разжижает кровь, что снижает риск сердечно-сосудистых заболеваний
  • Понижает содержание холестерина в крови
  • Улучшает пищеварение
  • Стимулирует иммунную систему
  • В некоторых случаях действует как антибиотик, сравнимый с действием пенициллина.
  • Уничтожает бактерии Helicobacter, что является хорошей профилактикой язвенной болезни и опухоли желудка.
  • Предупреждает развитие усталости

Интересный факт: лечебные свойства растения усиливаются в процессе брожения, в результате его обработки ферментами дрожжей.

Как чеснок противостоит вирусу

Чеснок оказывает иммуномодулирующее действие за счёт того, что регулирует выработку цитокинов (белки, которые синтезируются иммунными клетками), а также альфа интерферона. Это вещество изменяет мембраны клеток, не позволяя вирусу проникнуть внутрь. Также, альфа интерферон способствует выработке ферментов, которые препятствуют развитию вируса внутри клетки.

Простыми словами, растение делает наш организм более устойчивым к вирусным инфекциям и снижает риск осложнений от респираторных заболеваний, гриппа и ОРВИ.

Фитонциды, в составе чеснока, способны уничтожить возбудителей туберкулёза и различных грибковых инфекций. Препараты на его основе используют для лечения дизентерии, для подавления процессов гниения и брожения в кишечнике, для лечения трихомонадных кольпитов и заболеваний верхних дыхательных путей.

Кроме этого, аллицин в составе растения, подавляет стрептококковую инфекцию.

Сколько чеснока можно съедать в день

Согласно рекомендациям ВОЗ, ежедневная порция чеснока не должна превышать 2-5 грамм. Это приблизительно один зубчик.

В период вирусных инфекций, можно съедать чуть больше, но в любом случае нужно учитывать противопоказания и ваш возраст. Взрослым и детям от 10-12 лет допустимо съедать 3-4 зубчика в день.

Что будет если переесть чеснока

Уверена, что многим из нас нравится аромат и вкус чеснока, но употребляя его в слишком больших количествах мы можем получить противоположный результат.

Дело в том, что аллицин, благодаря которому растение имеет характерный запах и полезные свойства, в высоких концентрациях действует как яд. В результате чрезмерного употребления чеснока, на стенках желудка и кишечника могут появится повреждения и даже сквозные язвы. Также, вас может беспокоить изжога, диарея и повышенное газообразование.

Чрезмерное употребление чеснока, повышает риск внутренних кровотечений, тахикардии, либо снижения давления. В некоторых случаях возникают головные боли, замедляются реакции и появляется рассеянность.

Противопоказания

Употребление сырого чеснока не рекомендовано в следующих случаях:

  • Язвенная болезнь желудка и двенадцатиперстной кишки
  • Острые воспалительные процессы в почках и в мочевыделительной системе
  • Грудное вскармливание (приводит к беспокойству у младенцев)
  • Приём антикоагулянтов и антиагрегантов (вещества, которые препятствуют слипанию клеток крови)
  • Чеснок разжижает кровь, поэтому его нежелательно кушать во время менструаций, перед и после операций, а также перед посещением стоматолога.
  • Высокая аллергенность к продукту

Внимание! Ни в коем случае не ешьте чеснок на голодный желудок. Его активные вещества будут раздражать слизистую, что вызовет изжогу и неприятные ощущения в животе.

Не стоит кушать чеснок во время ужина. Он возбуждает нервную систему и мешает заснуть.

Чтобы продукт лучше усвоился, не запивайте его водой. Лучше всего употреблять его во время еды в обеденное время.

Безопасная альтернатива чесноку

Современные препараты на основе чеснока позволяют добиться большего эффекта и имеют минимальное количество противопоказаний, в сравнении с сырым растением. А ещё, их можно принимать в любое время дня, не переживая за запах изо рта.

Одним из лучших средств с чесноком считается FluGone. Его называют «скорой помощью» при вирусных инфекциях и воспалительных заболеваниях. Это натуральный антибиотик с чесноком, который усилен витамином С, порошком из плодов шиповника, цинком, селеном и экстрактом эхинацеи.

Единственное противопоказание к его приёму, это индивидуальная непереносимость. Поэтому его можно принимать людям с разным состоянием здоровья. Особенно FluGone полезен для людей с ослабленным иммунитетом, а также для профилактики и борьбы с вирусными инфекциями и воспалительными процессами в организме.

Переходите по ссылке и узнайте о FluGone подробнее.

При заказе на официальном сайте Santegra Shop, по номеру купона – 2888, действует 5% скидка!

Чеснок для сердечно-сосудистой системы

Аллицин в составе растения, улучшает состояние коронарных сосудов, предохраняет сердце от гипертрофии и улучшает внутрилёгочное кровообращение. Известно, что препараты с чесноком понижают артериальное давление, уменьшают концентрацию холестерина в составе крови, нормализуют ритм сердца и расширяют сосуды.

В клиническом исследовании было установлено, что приём экстракта чеснока, помогает снизить систолическое артериальное давление при гипертонии, а также снижает риск образования тромбов.

Ацетилцистеин растения, благодаря своим антиоксидантным свойствам предупреждает поражение почечной ткани при гипертонической болезни.

Чеснок и профилактика онкологии

Растение оказывает не только противоопухолевое и антиметастатическое воздействие, но и защищает нормальные клетки от продуктов распада опухоли, благодаря наличию органического селена и серы. Противоопухолевым свойством также обладают олигосахариды чеснока.

Мета анализ клинических рандомизированных исследований показал, что длительный приём чеснока предупреждает возникновение колоректального и эндометриального рака, а также рака предстательной железы.

Дополнительные свойства

  • В виду того, что значительная часть эфирных масле чеснока выделяется через лёгкие, это способствует разжижению мокроты. Также, это оказывает положительное воздействие на лёгкие курильщика.
  • Растение снижает риск болезни Альцгеймера и атеросклероза цереброваскулярных артерий.
  • Приём препаратов с чесноком предупреждает развитие остеопороза у женщин в период менопаузы, благодаря своим иммуномодулирующим свойствам.
  • Длительный приём чеснока улучшает память и защищает органы нервной системы от повреждений.
  • Порошок из сушёного чеснока хорошо помогает при лечении ран.
  • Биологически активные вещества в составе продукта предотвращают развитие ожирения.

Народные рецепты с чесноком

Настойка чеснока

Для её приготовления вам понадобится:

  • 40 грамм чеснока
  • 100 грамм водки

Чеснок заливается водкой и настаивается в течение 7 дней. Употребляют настойку по 10 капель 2-3 раза в день во время еды.

Ингаляции

Для ингаляций свежий сок чеснока смешивают с 0,25% раствором Новокаина, в пропорции 1:3.

Процедура помогает при воспалительных заболеваниях верхних дыхательных путей.

При кожных проблемах

Кашицу из чеснока с говяжьим жиром или свиным салом, наружно применяют при чесотке, экземе, бородавках, псориазе и мозолях. Также, это средство используют для уменьшения боли при ревматизме и радикулите.

От гипертонии

При гипертонической болезни берут 3 головки чеснока, 3 лимона и пропускают через мясорубку. К этой смеси добавляют 1,25 литра кипячёной воды и настаивают сутки. Употребляют настой по 1 столовой ложке 3 раза в день, перед едой.

От паразитов и глистов

1/2 чайной ложки сока чеснока смешивают с 0,5 стакана молока. Из полученного раствора делают микроклизму. Это средство очень эффективно при глистных инвазиях в желудочно-кишечном тракте.

Как народы мира используют чеснок

  • В болгарской народной медицине жареный чеснок с репчатым луком применяют наружно при лечении панарициев. Сок чеснока со свиным салом и мёдом втирают в кожу шеи при коклюше. Кашицу из свежих зубчиков наносят на кожу при чесотке и выпадении волос.
  • В Индии растение считается ветрогонным, отхаркивающим, глистогонным и омолаживающим средством. Его применяют для очищения крови и при хронических лихорадках. В Аюрведе чеснок применяется для лечения сердечных заболеваний.
  • В Мексике чеснок используют при укусах скорпионов.
  • В Нигерии продукт широко используется в терапии сахарного диабета и гипертонии.

Теперь вы точно знаете помогает ли чеснок от вирусов. Это удивительное средство полезно и при многих других проблемах со здоровьем. Поэтому обязательно употребляйте его в пищу, но знайте меру и дополнительно принимайте препараты с чесноком, которые позволят добиться отличного результата.

Берегите себя и будьте здоровы!

Эффективность чеснока при простуде

О полезных свойствах луковичных растений люди знают с древних времен. Как профилактическое средство от простудных заболеваний лук и чеснок активно использовали еще в Древнем Риме.

О полезных свойствах луковичных растений люди знают с древних времен. Как профилактическое средство от простудных заболеваний лук и чеснок активно использовали еще в Древнем Риме.

Лечебные свойства чеснока

Химический состав корнеплодов уникален. С их помощью человеческий организм быстро справляется с целым рядом болезнетворных бактерий и вирусов. Чеснок, помимо всего, еще и мощный профилактический инструмент предотвращения заражения микробами через воздух. Ежедневное употребление вместе с пищей нескольких зубчиков – качественная поддержка вашего иммунитета.

В чем полезность чеснока?

Как естественное и доступное всем лекарственное средство, его можно использовать в качестве дополнительного метода терапии и для профилактики разных заболеваний.

Наиболее важные эффекты:

  • отхаркивание;
  • обеззараживание;
  • противогрибковое и противомикробное действие;
  • регенерация тканей;
  • очистка ран.

Чеснок также оказывает антипаразитарный, общеукрепляющий, тонизирующий и антиоксидантный эффекты. А в качестве популярного средства для лечения простуды он практически опередил все другие целебные растения.

Чеснок и борьба с ОРЗ

В этом корнеплоде содержатся так называемые фитонциды. Это активные соединения, основной задачей которых является угнетение вредоносных для человека микроорганизмов.

Среди них:

  • большой спектр бактерий;
  • опасные микробы;
  • простейшие и грибки.

В растении много летучих веществ. Масло, выжимаемое из него, обладает иммуномодулирующими, противовирусными и антибактериальными свойствами. Важным компонентом чеснока является соединение серы с фунгицидным и бактерицидным эффектом, выделяющееся из него при откусывании.

Использование свежего корнеплода (или в качестве приправ и добавок в настойках) помогает повышать сопротивляемость организма и не допустить развития респираторных заболеваний в сезон простуда и гриппа.

Приобретайте средства от простуды самого высокого качества и по доступным ценам в сети аптек Столички.

Чеснок в пандемию: лечит или калечит?

https://ria.ru/20201010/chesnok-1579130164.html

Чеснок в пандемию: лечит или калечит?

Чеснок в пандемию: лечит или калечит?

Чеснок – отличное антибактериальное и противовирусное средство, стимулирующее иммунитет. Однако важно правильно его употреблять, чтобы не вызвать нежелательные... РИА Новости, 10.10.2020

2020-10-10T02:15

2020-10-10T02:15

2020-10-10T02:15

чеснок

иммунитет

здоровье - общество

общество

/html/head/meta[@name='og:title']/@content

/html/head/meta[@name='og:description']/@content

https://cdn25.img.ria.ru/images/07e4/03/14/1568911852_0:198:2936:1850_1920x0_80_0_0_a6a7f8ba0e23ac3709d558b532b44c9b.jpg

МОСКВА, 10 окт - РИА Новости. Чеснок – отличное антибактериальное и противовирусное средство, стимулирующее иммунитет. Однако важно правильно его употреблять, чтобы не вызвать нежелательные последствия, рассказал в интервью радио Sputnik гастроэнтеролог Никита Харлов.Чеснок издавна используется в лечебных целях. Это растение содержит множество полезных веществ и оказывает стимулирующий эффект на иммунитет, что очень важно в разгар вирусных инфекций и пандемии коронавируса. Но это не значит, что его можно употреблять в любом виде. От сырого чеснока лучше отказаться, предупредил в интервью радио Sputnik cемейный врач, гастроэнтеролог Никита Харлов.Не стоит использовать и капли из чеснока для носа, советует врач. Так вы, наоборот, освободите дорогу вирусам. "Раздражение слизистых будет приводить к тому, что будет снижаться местный защитный барьер, будет возникать отек, все будет течь, от этого защиты нет. Нарушая целостность слизистой оболочки, на которой уже находятся антитела, вы увеличиваете доступность слизистой для вирусов и бактерий, которые могут туда проникнуть. Иногда советуют вешать чеснок на шею с целью защиты от различных инфекций. В этом способе нет значимой практической ценности, так как концентрации при вдыхании будут маленькие", – сказал Никита Харлов.Чеснок надо использовать в составе готовых блюд. "При приготовлении пищи можете использовать чеснок, как вам нравится. Можно брать свежий, можно сушеный, запекать с ним, варить, натирать им все продукты, которые вы готовите. Хорошо предварительно зубчики нарезать и дать им полежать в сыром виде, от этого чеснок станет сильнее, потому что на воздухе в нем усиливается образование веществ из-за которых его так ценят. Подготовленный таким образом чеснок хорошо использовать для готовки, но ни в коем случае не в сыром виде", – подчеркнул гастроэнтеролог. Никита Харлов также поделился рецептом приготовления очень полезного напитка с чесноком. Правда, подойдет он только тем, у кого нет непереносимости лактозы. "Нужно взять непастеризованное молоко хорошего качества и сделать из него кефир или йогурт. Для этого нужно молоко налить в стеклянную емкость, накрыть марлей и поставить на 48-72 часа в темный шкаф, предварительно добавив туда чеснок – зубчик или даже чуть меньше на пол-литра. Чеснок обезвреживает молоко от всех паразитов, которые там могут оказаться, в частности, от грибков рода кандида. С другой стороны, молочно-кислые бактерии, которые обладают резистентностью к чесноку, хорошо на нем размножаются, питаясь крахмалом, который в нем есть. Получается настоящий супер-фуд, который можно использовать как пробиотик, потому что в нем много молочно-кислых бактерий", – объяснил в беседе с радио Sputnik гастроэнтеролог Никита Харлов.

https://ria.ru/20200815/1575834691.html

https://radiosputnik.ria.ru/20200413/1569988471.html

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

2020

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Новости

ru-RU

https://ria.ru/docs/about/copyright.html

https://xn--c1acbl2abdlkab1og.xn--p1ai/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

https://cdn25.img.ria.ru/images/07e4/03/14/1568911852_103:0:2834:2048_1920x0_80_0_0_7c3b4d667b806f1678bdca60aa3e03b0.jpg

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

чеснок, иммунитет, здоровье - общество, общество

МОСКВА, 10 окт - РИА Новости. Чеснок – отличное антибактериальное и противовирусное средство, стимулирующее иммунитет. Однако важно правильно его употреблять, чтобы не вызвать нежелательные последствия, рассказал в интервью радио Sputnik гастроэнтеролог Никита Харлов.

Чеснок издавна используется в лечебных целях. Это растение содержит множество полезных веществ и оказывает стимулирующий эффект на иммунитет, что очень важно в разгар вирусных инфекций и пандемии коронавируса. Но это не значит, что его можно употреблять в любом виде.

От сырого чеснока лучше отказаться, предупредил в интервью радио Sputnik cемейный врач, гастроэнтеролог Никита Харлов.

"Чеснок – это сильный антибиотик, сильное антивирусное средство, поэтому обычно он используется для обезвреживания, обеззараживания продуктов животного происхождения. Но настоятельно рекомендую не употреблять чеснок в сыром виде: он не только убивает бактерии и грибки, он сильно раздражает слизистую пищеварительного тракта: и желудка (он более выносливый), и особенно кишечника. У людей, у которых может быть гастродуоденит, синдром раздраженного кишечника, это может вызывать серьезную ответную реакцию вплоть до срыва стула", – сказал Никита Харлов.

Не стоит использовать и капли из чеснока для носа, советует врач. Так вы, наоборот, освободите дорогу вирусам.

"Раздражение слизистых будет приводить к тому, что будет снижаться местный защитный барьер, будет возникать отек, все будет течь, от этого защиты нет. Нарушая целостность слизистой оболочки, на которой уже находятся антитела, вы увеличиваете доступность слизистой для вирусов и бактерий, которые могут туда проникнуть. Иногда советуют вешать чеснок на шею с целью защиты от различных инфекций. В этом способе нет значимой практической ценности, так как концентрации при вдыхании будут маленькие", – сказал Никита Харлов.

15 августа 2020, 18:26

Раскрыты два простых способа избавиться от запаха чеснока

Чеснок надо использовать в составе готовых блюд.

"При приготовлении пищи можете использовать чеснок, как вам нравится. Можно брать свежий, можно сушеный, запекать с ним, варить, натирать им все продукты, которые вы готовите. Хорошо предварительно зубчики нарезать и дать им полежать в сыром виде, от этого чеснок станет сильнее, потому что на воздухе в нем усиливается образование веществ из-за которых его так ценят. Подготовленный таким образом чеснок хорошо использовать для готовки, но ни в коем случае не в сыром виде", – подчеркнул гастроэнтеролог.

Никита Харлов также поделился рецептом приготовления очень полезного напитка с чесноком. Правда, подойдет он только тем, у кого нет непереносимости лактозы.

"Нужно взять непастеризованное молоко хорошего качества и сделать из него кефир или йогурт. Для этого нужно молоко налить в стеклянную емкость, накрыть марлей и поставить на 48-72 часа в темный шкаф, предварительно добавив туда чеснок – зубчик или даже чуть меньше на пол-литра. Чеснок обезвреживает молоко от всех паразитов, которые там могут оказаться, в частности, от грибков рода кандида. С другой стороны, молочно-кислые бактерии, которые обладают резистентностью к чесноку, хорошо на нем размножаются, питаясь крахмалом, который в нем есть. Получается настоящий супер-фуд, который можно использовать как пробиотик, потому что в нем много молочно-кислых бактерий", – объяснил в беседе с радио Sputnik гастроэнтеролог Никита Харлов.

13 апреля 2020, 19:42

Эксперт оценила пользу чеснока и лимонов от COVID-19

Иммунолог развеяла популярные мифы о противовирусных свойствах чеснока и имбиря

Чеснок и имбирь оказывают противомикробное действие, однако, чтобы добиться эффекта, при котором эти продукты помогают иммунитету, нужно употреблять их систематически и в небольших количествах. Об этом рассказала врач — иммунолог-аллерголог Марина Аплетаева.

Чеснок, имбирь, лук — продукты с высоким содержанием веществ, которые обладают в основном противомикробной активностью. Это пищевые продукты. Если мы хотим получить от них хоть какую-то пользу для иммунитета, их нужно употреблять регулярно и в маленьких количествах, чтобы не навредить, — приводит слова врача РИА ФАН.

Аплетаева отметила, что миф о чудесных свойствах этих продуктов пришёл из древних времён, когда люди боролись не с вирусами, а с бактериями.

Вообще же употреблять чеснок и имбирь нужно с осторожностью, особенно это касается второго растения. Оно раздражает оболочку ротовой полости и желудка и в больших количествах может вызвать гастрит и язвы, что негативно скажется на работе иммунной системы, добавила доктор.

"Зуб дракона" против вирусов и бактерий: чем полезен чеснок

https://ria.ru/20201119/chesnok-1585391554.html

"Зуб дракона" против вирусов и бактерий: чем полезен чеснок

"Зуб дракона" против вирусов и бактерий: чем полезен чеснок

Чеснок — это отличный стимулятор иммунитета. Как он помогает организму человека и когда может нанести вред – в материале РИА Новости. РИА Новости, 19.11.2020

2020-11-19T17:10

2020-11-19T17:10

2020-11-19T18:13

чеснок

юго-восточная азия

китай

еда

продукты

общество

/html/head/meta[@name='og:title']/@content

/html/head/meta[@name='og:description']/@content

https://cdn25.img.ria.ru/images/93043/80/930438000_0:105:2000:1230_1920x0_80_0_0_c79f55da8f42f1afcfd8fb5651395985.jpg

МОСКВА, 19 ноя – РИА Новости. Чеснок — это отличный стимулятор иммунитета. Как он помогает организму человека и когда может нанести вред – в материале РИА Новости.Родина и история чеснокаМноголетнее растение из рода Лук стали культивировать в Средней и Юго-Восточной Азии 5 тысяч лет назад. Местные жители использовали этот овощ в качестве лекарства, но в пищу не употребляли из-за резкого запаха.В античности растение возделывали римляне, греки, египтяне, арабы и евреи. Продукт упоминается в мифологии и различных поверьях этих народов. Люди защищались с помощью чеснока от злых духов, вычисляли ведьм.Название растения на Руси произошло от глаголов "чесать" и "рвать" и обозначает "расколотая луковица". В Китае чеснок называли "зубом дракона" из-за внешнего вида, а также "вонючей розой" из-за ядреного запаха. Чем полезен чеснокГлавное достоинство продукта – содержащиеся в нем фитонциды. Это летучие вещества, которые подавляют рост бактерий, вирусов и грибков и стимулируют рост микроорганизмов-защитников. Такое свойство чеснока помогает ему также бороться и с паразитами в кишечнике.Кроме того, растение обладает антиоксидантными свойствами – выводит свободные радикалы, которые "окисляют" клетки организма, ускоряя процессы старения. Также в умеренных количествах чеснок является защитой от болезней печени: он стимулирует регенерацию ее клеток, способствует выведению токсинов.Помимо всего, в чесноке есть витамин C, витамины группы B, калий, кальций, фосфор, магний, натрий, селен, марганец, йод.КБЖУ в 100 граммах чеснока:Когда он опасенНесмотря на всю пользу, которую несет в себе чеснок, существуют и противопоказания к его применению. Например, его нельзя употреблять часто, а также стоит воздержаться от приема натощак и на ночь.Не стоит использовать и капли из чеснока для носа. По словам врача, такой "препарат" наоборот освободит дорогу вирусам, так как раздражение слизистых приведет к снижению местного защитного барьера.Также эксперт отметил, что в висящем на шее чесноке толку нет, так как концентрация полезных веществ растения при вдыхании будет невысока.В большом количестве чеснок вреден для беременных женщин, так как может спровоцировать преждевременные роды. При грудном вскармливании лучше избегать этого продукта, поскольку содержащиеся в нем вещества способны изменить вкус молока, и малыш может отказаться от груди.Как применяют в медицинеИздавна люди применяли чеснок как средство, понижающее артериальное давление. Он убивает "вредный" холестерин, провоцирующий образование атеросклеротических бляшек, уменьшает напряжение стенок сосудов и способствует активному кровотоку.Селен в составе чеснока помогает организму защищаться от онкологических заболеваний, а также способствует сохранению здоровья щитовидной железы. Витамин В6 влияет на работу центральной нервной системы - способствует выработке серотонина, которого в народе называют "гормоном счастья".Помогает чеснок и в борьбе с простудными заболеваниями. Принято считать, что люди, употребляющие этот продукт, простужаются значительно реже, чем те, кто его не ест совсем.Многие компании выпускают и биодобавки на основе растения - чеснок в капсулах. Их преимущество – отсутствие неприятного запаха.Применение в кулинарииВ пищу потребляют не только зубчики, но и листья, цветоносы, "стрелки" еще зеленого чеснока. Их маринуют, обжаривают, запекают в качестве приправы. Также из растения варят супы. Для повышения иммунитета из чеснока делают настойки на воде или молоке, смешивают с медом.Соус с чесноком для курицыИнгредиенты:Приготовление:На среднем огне разогреть сливки и растопить в них натертый сыр. В полученную массу добавить специи по вкусу, немного растительного масла и пропущенный через пресс чеснок. Затем все перемешать и снять с огня через две минуты. Готовый соус остудить и добавить измельченную зелень.Малосольные баклажаны с чеснокомИнгредиенты:Приготовление:Баклажаны помыть и нарезать на кубики среднего размера. Затем нужно приготовить рассол: на 2 литра воды - 2 столовых ложки соли. Полученный состав вскипятить, засыпать в него баклажаны и варить в течение 5 минут. После откинуть баклажаны на дуршлаг, просушить и положить в миску. Добавить к ним измельченную зелень и чеснок, ароматное растительное масло, и все перемешать. Накрыть крышкой и поставить в холодильник на 12 часов.Печеный чеснокИнгредиенты:Приготовление:С каждой головки чеснока снять тонкий слой шелухи, а верхушку срезать так, чтобы оголить зубчики. На противень или в форму для запекания выложить лист фольги. На него - чесночные головки. Сверху посолить и полить маслом. Затем завернуть чеснок в фольгу и отправить его запекаться при температуре 200 градусов в духовку на 25-30 минут.Как выбрать и хранитьХороший продукт должен быть с твердыми и сухими зубчиками. Наиболее тонкий вкус имеют средние по размеру головки. Если чеснок уже прорастает, покупать его не стоит, так как в нем намного меньше полезных веществ. К тому же, он быстрее испортится.Хранить растение следует в сухом темном месте при комнатной температуре в коробке или связке. В холодильнике он может загнить от влажности.Как правильно употреблять— Растение может нанести вред, если принимать его в сыром виде. Правильно есть чеснок именно в составе готовых блюд. Можно брать свежий или сушеный. Запекать с ним или варить. Натирать зубчиками все продукты, которые вы готовите. Хорошо перед готовкой нарезать чеснок и дать ему полежать в сыром виде. От этого он станет только полезнее, так как на воздухе в нем усиливается образование веществ, из-за которых его так ценят. Подготовленный таким образом продукт нужно использовать для готовки, но ни в коем случае не в сыром виде, — подчеркнул Никита Харлов.

https://ria.ru/20201105/mif-1583100754.html

https://ria.ru/20201023/chesnok-1581132298.html

https://ria.ru/20201010/chesnok-1579130164.html

https://ria.ru/20201027/produkty-1581780894.html

https://ria.ru/20201115/eda-1584058009.html

юго-восточная азия

китай

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

2020

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

Новости

ru-RU

https://ria.ru/docs/about/copyright.html

https://xn--c1acbl2abdlkab1og.xn--p1ai/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

https://cdn25.img.ria.ru/images/93043/80/930438000_112:0:1889:1333_1920x0_80_0_0_e7e7fc4c43a56d1fbd3d9c8651b8b5b0.jpg

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

РИА Новости

[email protected]

7 495 645-6601

ФГУП МИА «Россия сегодня»

https://xn--c1acbl2abdlkab1og.xn--p1ai/awards/

чеснок, юго-восточная азия, китай, еда, продукты, общество

МОСКВА, 19 ноя – РИА Новости. Чеснок — это отличный стимулятор иммунитета. Как он помогает организму человека и когда может нанести вред – в материале РИА Новости.

Родина и история чеснока

Многолетнее растение из рода Лук стали культивировать в Средней и Юго-Восточной Азии 5 тысяч лет назад. Местные жители использовали этот овощ в качестве лекарства, но в пищу не употребляли из-за резкого запаха.

В античности растение возделывали римляне, греки, египтяне, арабы и евреи. Продукт упоминается в мифологии и различных поверьях этих народов. Люди защищались с помощью чеснока от злых духов, вычисляли ведьм.

Название растения на Руси произошло от глаголов "чесать" и "рвать" и обозначает "расколотая луковица". В Китае чеснок называли "зубом дракона" из-за внешнего вида, а также "вонючей розой" из-за ядреного запаха.

5 ноября 2020, 06:09

В Роспотребнадзоре развеяли миф о чесноке и луке

Чем полезен чеснок

Главное достоинство продукта – содержащиеся в нем фитонциды. Это летучие вещества, которые подавляют рост бактерий, вирусов и грибков и стимулируют рост микроорганизмов-защитников. Такое свойство чеснока помогает ему также бороться и с паразитами в кишечнике.

- Чеснок – отличное антибактериальное и противовирусное средство, стимулирующее иммунитет. Это сильный антибиотик, поэтому он часто используется для обезвреживания, обеззараживания продуктов животного происхождения, - рассказал РИА Новости cемейный врач, гастроэнтеролог Никита Харлов.

Кроме того, растение обладает антиоксидантными свойствами – выводит свободные радикалы, которые "окисляют" клетки организма, ускоряя процессы старения. Также в умеренных количествах чеснок является защитой от болезней печени: он стимулирует регенерацию ее клеток, способствует выведению токсинов.

Помимо всего, в чесноке есть витамин C, витамины группы B, калий, кальций, фосфор, магний, натрий, селен, марганец, йод.

КБЖУ в 100 граммах чеснока:

  • 149 килокалорий;
  • 6,5 грамма белков;
  • 0,5 грамма жиров;
  • 30 грамм углеводов.

Когда он опасен

Несмотря на всю пользу, которую несет в себе чеснок, существуют и противопоказания к его применению. Например, его нельзя употреблять часто, а также стоит воздержаться от приема натощак и на ночь.

- В сыром виде чеснок может нанести вред. Он сильно раздражает слизистую пищеварительного тракта: и желудка, и особенно кишечника. У людей с гастродуоденитом, синдромом раздраженного кишечника продукт может вызывать серьезную ответную реакцию вплоть до срыва стула, - отметил гастроэнтеролог.

Не стоит использовать и капли из чеснока для носа. По словам врача, такой "препарат" наоборот освободит дорогу вирусам, так как раздражение слизистых приведет к снижению местного защитного барьера.

23 октября 2020, 09:42

Назван популярный кулинарный прием, делающий чеснок смертельно опасным

Также эксперт отметил, что в висящем на шее чесноке толку нет, так как концентрация полезных веществ растения при вдыхании будет невысока.

В большом количестве чеснок вреден для беременных женщин, так как может спровоцировать преждевременные роды. При грудном вскармливании лучше избегать этого продукта, поскольку содержащиеся в нем вещества способны изменить вкус молока, и малыш может отказаться от груди.

Как применяют в медицине

Издавна люди применяли чеснок как средство, понижающее артериальное давление. Он убивает "вредный" холестерин, провоцирующий образование атеросклеротических бляшек, уменьшает напряжение стенок сосудов и способствует активному кровотоку.

Селен в составе чеснока помогает организму защищаться от онкологических заболеваний, а также способствует сохранению здоровья щитовидной железы. Витамин В6 влияет на работу центральной нервной системы - способствует выработке серотонина, которого в народе называют "гормоном счастья".

Помогает чеснок и в борьбе с простудными заболеваниями. Принято считать, что люди, употребляющие этот продукт, простужаются значительно реже, чем те, кто его не ест совсем.

Многие компании выпускают и биодобавки на основе растения - чеснок в капсулах. Их преимущество – отсутствие неприятного запаха.

10 октября 2020, 02:15

Чеснок в пандемию: лечит или калечит?

Применение в кулинарии

В пищу потребляют не только зубчики, но и листья, цветоносы, "стрелки" еще зеленого чеснока. Их маринуют, обжаривают, запекают в качестве приправы. Также из растения варят супы. Для повышения иммунитета из чеснока делают настойки на воде или молоке, смешивают с медом.

Соус с чесноком для курицы

  • 450 миллилитров сливок;
  • 120 грамм пармезана;
  • 3 зубчика чеснока;
  • зелень и специи по вкусу.

Приготовление:

На среднем огне разогреть сливки и растопить в них натертый сыр. В полученную массу добавить специи по вкусу, немного растительного масла и пропущенный через пресс чеснок. Затем все перемешать и снять с огня через две минуты. Готовый соус остудить и добавить измельченную зелень.

Малосольные баклажаны с чесноком

  • 700 грамм баклажанов;
  • 3 зубчика чеснока;
  • 1 пучок петрушки;
  • 2 столовых ложки 6-процентного яблочного уксуса;
  • 2 столовых ложки соли;
  • 2 литра воды;
  • 3-4 столовых ложки растительного нерафинированного масла.

Приготовление:

Баклажаны помыть и нарезать на кубики среднего размера. Затем нужно приготовить рассол: на 2 литра воды - 2 столовых ложки соли. Полученный состав вскипятить, засыпать в него баклажаны и варить в течение 5 минут. После откинуть баклажаны на дуршлаг, просушить и положить в миску. Добавить к ним измельченную зелень и чеснок, ароматное растительное масло, и все перемешать. Накрыть крышкой и поставить в холодильник на 12 часов.

Печеный чеснок

  • 4 чесночные головки;
  • 1 столовая ложка подсолнечного или оливкового масла;
  • соль по вкусу.

Приготовление:

С каждой головки чеснока снять тонкий слой шелухи, а верхушку срезать так, чтобы оголить зубчики. На противень или в форму для запекания выложить лист фольги. На него - чесночные головки. Сверху посолить и полить маслом. Затем завернуть чеснок в фольгу и отправить его запекаться при температуре 200 градусов в духовку на 25-30 минут.

27 октября 2020, 16:12

В России вырос импорт чеснока и имбиря

Как выбрать и хранить

Хороший продукт должен быть с твердыми и сухими зубчиками. Наиболее тонкий вкус имеют средние по размеру головки. Если чеснок уже прорастает, покупать его не стоит, так как в нем намного меньше полезных веществ. К тому же, он быстрее испортится.

Хранить растение следует в сухом темном месте при комнатной температуре в коробке или связке. В холодильнике он может загнить от влажности.

Как правильно употреблять

— Растение может нанести вред, если принимать его в сыром виде. Правильно есть чеснок именно в составе готовых блюд. Можно брать свежий или сушеный. Запекать с ним или варить. Натирать зубчиками все продукты, которые вы готовите. Хорошо перед готовкой нарезать чеснок и дать ему полежать в сыром виде. От этого он станет только полезнее, так как на воздухе в нем усиливается образование веществ, из-за которых его так ценят. Подготовленный таким образом продукт нужно использовать для готовки, но ни в коем случае не в сыром вид

Как чеснок борется с простудой и гриппом

Чеснок веками использовался как пищевой ингредиент и как лекарство.

На самом деле, употребление чеснока может принести много пользы для здоровья (1).

Это включает снижение риска сердечных заболеваний, улучшение психического здоровья и усиление иммунной функции (2, 3, 4, 5, 6).

В этой статье объясняется, как чеснок защищает от простуды и гриппа.

Чеснок может повысить иммунную функцию

Чеснок содержит соединения, которые помогают иммунной системе бороться с микробами (5, 6).

Целый чеснок содержит соединение, называемое аллиином. При измельчении или жевании чеснока это соединение превращается в аллицин (с номером c ), основной активный ингредиент чеснока (7).

Аллицин содержит серу, которая придает чесноку характерный запах и вкус (8).

Однако аллицин нестабилен, поэтому он быстро превращается в другие серосодержащие соединения, которые, как считается, придают чесноку его лечебные свойства (5).

Было показано, что эти соединения усиливают реакцию некоторых типов белых кровяных телец в организме на борьбу с болезнями, когда они сталкиваются с вирусами, такими как вирусы, вызывающие простуду или грипп (5, 9).

Итог:

Чеснок можно измельчить, жевать или нарезать, чтобы получить аллицин, который, как считается, придает чесноку его иммуностимулирующие свойства.

Может ли чеснок предотвратить простуду и грипп?

Чеснок оказался многообещающим средством от простуды и гриппа.

Исследования показали, что чеснок в первую очередь снижает риск заболевания, а также снижает продолжительность болезни. Он также может уменьшить тяжесть симптомов (9, 10).

Одно исследование давало 146 здоровым добровольцам чесночные добавки или плацебо в течение трех месяцев. В группе чеснока риск простуды был на 63% ниже, а простудные заболевания были на 70% короче (11).

Другое исследование показало, что простудные заболевания были в среднем на 61% короче у субъектов, которые ели 2,56 грамма выдержанного экстракта чеснока в день, по сравнению с группой плацебо. Их простуды также были менее тяжелыми (9).

Если вы часто болеете простудой или гриппом, употребление чеснока может помочь уменьшить симптомы или полностью предотвратить болезнь.

Однако обзор данных показал, что многие исследования, посвященные влиянию чеснока на простуду, были низкого качества (12).

Также неизвестно, нужно ли вам постоянно принимать чеснок или он также действует как краткосрочное лечение, когда вы начинаете болеть.

Итог:

Регулярное употребление чеснока может помочь предотвратить простуду или грипп. Если вы заболеете, употребление чеснока может уменьшить тяжесть симптомов и ускорить выздоровление.

Как получить максимальную пользу от чеснока

Способ обработки или приготовления чеснока действительно может изменить его пользу для здоровья.

Фермент аллииназа, превращающий аллиин в полезный аллицин, работает только при определенных условиях. Его также можно отключить с помощью тепла.

Одно исследование показало, что всего 60 секунд в микроволновой печи или 45 минут в духовке могут дезактивировать аллииназу, а другое исследование показало аналогичные результаты (13, 14).

Однако было отмечено, что измельчение чеснока и выдержка в течение 10 минут перед приготовлением может помочь предотвратить потерю его лечебных свойств.

Исследователи также заявили, что потеря пользы для здоровья из-за приготовления пищи может быть компенсирована увеличением количества используемого чеснока.

Вот несколько способов максимизировать пользу чеснока для здоровья:

  • Измельчите или нарежьте весь чеснок перед тем, как съесть его. Это увеличивает содержание аллицина.
  • Прежде чем готовить с измельченным чесноком, дайте ему постоять 10 минут.
  • Используйте много чеснока - по возможности, больше одного зубчика на прием пищи.
Итог:

Убедитесь, что весь чеснок раздавлен, пережеван или нарезан перед употреблением в пищу.Дайте измельченному чесноку постоять 10 минут, прежде чем готовить.

Еще один простой способ увеличить потребление чеснока - это принимать добавки.

Однако будьте осторожны, так как нет регулируемых стандартов для добавок с чесноком.

Это означает, что содержание и качество аллицина могут варьироваться, как и польза для здоровья.

Порошок чеснока

Порошок чеснока делают из свежего чеснока, нарезанного и высушенного. Он не содержит аллицина, но, как говорят, обладает потенциалом аллицина .

Порошок чеснока обрабатывают при низких температурах, а затем помещают в капсулы, чтобы защитить его от желудочной кислоты.

Это помогает ферменту аллииназе выжить в суровых условиях желудка, так что он может преобразовать аллиин в полезный аллицин в кишечнике.

К сожалению, неясно, сколько аллицина можно получить из порошкообразных добавок с чесноком. Это сильно зависит от марки и препарата (15, 16).

Экстракт выдержанного чеснока

Когда сырой чеснок был нарезан и хранился в 15–20% этаноле более 1 раза.Через 5 лет он становится выдержанным экстрактом чеснока.

Этот тип добавок не содержит аллицин, но сохраняет лечебные свойства чеснока. Во многих исследованиях, показывающих преимущества против простуды и гриппа, использовался экстракт выдержанного чеснока (2, 9, 17).

Масло чеснока

Масло чеснока также является эффективной добавкой, его получают путем добавления сырого чеснока в кулинарные масла. Вы можете добавлять его прямо в еду или принимать в капсулах.

Однако стоит отметить, что исследования на животных показали, что чесночное масло может быть токсичным для крыс в более высоких дозах и в определенных условиях (18).

Домашнее чесночное масло также связано с несколькими случаями ботулизма, поэтому, если вы собираетесь приготовить собственное, обязательно используйте надлежащие методы консервации (19, 20, 21).

Итог:

Общие типы чесночных добавок включают измельченный чеснок, экстракт выдержанного чеснока и чесночное масло. Экстракт выдержанного чеснока может быть лучшим вариантом.

Сколько чеснока нужно есть в день?

Минимальная эффективная доза сырого чеснока - один долька (зубчик), съедаемая два-три раза в день.

Также можно принимать добавку из выдержанного чеснока. В этом случае нормальная доза составляет от 600 до 1200 мг в день.

Большое количество добавок с чесноком может быть токсичным, поэтому не превышайте рекомендуемые дозы.

Итог:

Вы можете получить пользу от чеснока, съедая 2-3 зубчика чеснока в день. Дозы добавок колеблются от 600 до 1200 мг в день.

Другие советы по укреплению иммунной функции

Вот еще 5 способов повысить иммунную функцию и помочь вам избежать простуды и гриппа:

  1. Примите пробиотик: Пробиотики могут способствовать здоровью кишечника, укреплять вашу иммунную систему и снизить риск заражения (22, 23, 24, 25).
  2. Соблюдайте здоровую и сбалансированную диету: Весь ваш рацион очень важен. Баланс важных питательных веществ позволит вашей иммунной системе оставаться в хорошей форме.
  3. Не кури: Сигаретный дым может ослабить вашу иммунную систему и сделать вас более подверженными инфекциям (26, 27, 28).
  4. Избегайте чрезмерного употребления алкоголя: Считается, что избыток алкоголя наносит вред вашей иммунной системе и делает вас более восприимчивым к инфекциям (29, 30, 31).
  5. Примите добавку цинка: Принимайте леденцы с цинком или сироп в течение 24 часов после начала простуды, так как это может сократить продолжительность простуды (32).
Итог:

Здоровое питание и образ жизни необходимы для поддержания вашей иммунной системы в хорошей форме.

Исследования показывают, что чеснок помогает бороться с простудой и гриппом. Это может снизить ваши шансы подхватить болезнь и помочь вам быстрее выздороветь.

Чтобы максимизировать эти преимущества, лучше всего употреблять сырой чеснок или выдержанный чесночный экстракт.

В конце концов, чеснок вкусен и очень полезен. Тогда есть много других веских причин включить его в свой рацион.

.

Преимущества, влияние на лекарства от ВИЧ и многое другое

Чеснок уже давно рекламируется как альтернативное средство от ряда проблем со здоровьем. Ему приписывают множество преимуществ, от снижения холестерина до возможной профилактики рака. Может показаться, что есть больше чеснока, и ежу понятно.

Его очевидная способность помогать с холестерином может быть желательной для людей, принимающих лекарства от ВИЧ, которые могут повышать уровень холестерина. Есть также некоторые доказательства того, что чеснок может оказывать противомикробное и иммуностимулирующее действие.

Прежде чем измельчать, измельчать и добавлять эту траву в свой рацион, имейте в виду, что чеснок может негативно взаимодействовать с лекарствами, включая некоторые антиретровирусные препараты.

Узнайте о рисках и преимуществах чеснока и узнайте, как одно из его химических веществ может принести больше вреда, чем пользы.

Чеснок может влиять на то, как быстро организм расщепляет лекарственные препараты, в том числе те, которые используются для лечения ВИЧ. Если человек принимает чеснок вместе с уязвимым лекарством, у него может оказаться слишком много или слишком мало лекарства в кровотоке.Это может повлиять на эффективность лечения от ВИЧ.

В обзоре литературы за 2017 год сделан вывод о том, что некоторые формы чеснока значительно снижают уровень некоторых антиретровирусных препаратов и не должны использоваться людьми, живущими с ВИЧ.

Ингибиторы протеазы

В небольшом исследовании 2002 года, опубликованном в журнале Clinical Infectious Diseases, исследователи изучали влияние чеснока на саквинавир, лекарство от ВИЧ. Они обнаружили, что прием чесночных добавок с саквинавиром значительно снизил уровень препарата в кровотоке, на 30-40 процентов.

Исследователи рекомендовали людям проявлять осторожность при сочетании чеснока с саквинавиром в качестве единственного ингибитора протеазы.

В исследовании 2010 года в пробирке с участием животных, экстракт выдержанного чеснока подавлял активность саквинавира. Однако он усиливал активность дарунавира, другого ингибитора протеазы.

В соответствии с инструкциями по применению Инвираза, фирменной версии саквинавира, совместное применение саквинавира и чесночных капсул не рекомендуется.

Другие лекарства от ВИЧ

Согласно исследованию 2017 года, людям также следует избегать чесночных добавок, если они принимают следующие лекарства от ВИЧ:

  • ненуклеозидные ингибиторы обратной транскриптазы (ННИОТ), которые включают эфавиренц (Sustiva) и рилпивирин (Edurant )
  • долутегравир (Tivicay)
  • maraviroc (Selzentry)
  • элвитегравир, усиленный кобицистатом

Это связано с возможностью лекарственных взаимодействий.

Поговорите с лечащим врачом

Если какое-либо из вышеперечисленных лекарств входит в схему лечения человека от ВИЧ, ему следует поговорить со своим врачом о приеме чесночных добавок.

Для них может быть безопасно добавлять чеснок в еду, но их лечащий врач сможет сказать им, может ли большое количество чеснока или чесночных добавок помешать их лечению от ВИЧ.

Помимо потенциальных лекарственных взаимодействий, чеснок может вызывать побочные эффекты, которые могут повлиять на способность человека принимать лекарства от ВИЧ. Побочные эффекты чеснока могут имитировать некоторые симптомы, вызванные ВИЧ или СПИДом.

Вы можете спросить врача, как отличить воздействие чеснока от симптомов, вызванных ВИЧ или СПИДом.

Побочные эффекты чеснока включают:

Поскольку чеснок может разжижать кровь, у некоторых людей он может вызвать кровотечение. Человек должен помнить о своем потреблении чеснока, если он:

Если человек попадает в один из перечисленных выше сценариев, ему может быть хорошей идеей поговорить со своим врачом об использовании добавок чеснока или потреблении продуктов, содержащих большое количество чеснока.

Человек, живущий с ВИЧ, должен сообщить своему лечащему врачу обо всех лекарствах и травах, которые он принимает, даже о тех, которые покупаются без рецепта.Медицинский работник может сообщить им, может ли сырой чеснок или чеснок в бутылках помочь их здоровью и может ли он помешать их плану лечения ВИЧ.

Фармацевт также является отличным источником информации о взаимодействии лекарств и добавок.

.

Коронавирус: эксперты взвешивают, может ли чеснок защитить от смертельного вируса.

Хорошо известный чеснок обладает антибактериальными и противовирусными свойствами, которые могут помочь бороться с простудой.

Чеснок веками использовался как ингредиент пищи и лекарство. Чеснок содержит соединения, которые помогают иммунной системе бороться с микробами.

Целый чеснок содержит соединение под названием аллиин. Когда чеснок измельчают или разжевывают, это соединение превращается в аллицин, который является основным активным ингредиентом чеснока.

Аллицин содержит серу, которая придает чесноку характерный вкус. Однако аллицин нестабилен, поэтому он быстро превращается в другие серосодержащие соединения, которые, как считается, придают чесноку его лечебные свойства.

Было показано, что эти соединения усиливают реакцию некоторых типов белых кровяных телец в организме на борьбу с болезнями, когда они сталкиваются с вирусами, такими как вирусы, вызывающие простуду или грипп.

Может ли чеснок защитить человека от коронавируса?

ПРОЧИТАЙТЕ БОЛЬШЕ: Предупреждение о потреблении соли: эксперт обнаруживает скрытые опасности употребления слишком большого количества соли

.

Чеснок может убить 14 видов рака и 13 инфекций

Последнее обновление

Если у вас рак или хроническое заболевание, вы, вероятно, слышали, что употребление большого количества овощей может побороть болезнь и укрепить организм нутритивная поддержка, необходимая для того, чтобы выдержать химиотерапию и другие прописанные вам лекарства.

Один «овощ», в частности, чеснок, содержит вещества, которые являются особенно мощным оружием против рака, сообщает Американский институт исследований рака .Поэтому включение чеснока в свой рацион может помочь в лечении рака.

Чудесная лечебная еда: чеснок

Основная польза чеснока для здоровья обусловлена ​​сернистым соединением, известным как аллицин , которое также придает чесноку резкий запах. Всего один миллиграмм аллицина почти в 15 раз эффективнее пенициллина.

Соединение предлагает широкий спектр защиты от патогенных бактерий, вирусов, паразитов, устойчивых к антибиотикам MRSA, дрожжевых инфекций и является одним из многих удивительных продуктов, борющихся с раком.

Чеснок содержит 33 активных серосодержащих вещества. При проглатывании аллицин превращается в сульфеновую кислоту, которая является самым быстродействующим нейтрализатором свободных радикалов, без исключений. Недавно Университет Флориды обнаружил, что употребление чеснока увеличивает количество Т-клеток, борющихся с вирусом, в кровотоке.

Сообразительные эксперты в области здравоохранения все чаще рекомендуют употребление цельных продуктов в качестве основного метода исцеления в отличие от приема добавок, особенно когда речь идет о чесноке. Употребление свежего сырого чеснока - безусловно, лучший способ обеспечить многочисленные преимущества чеснока для здоровья.

Наилучший способ употребления чеснока в здоровых целях - сначала надавить на свежий зубчик чесночного пресса, или порубить его, или разбить тыльной стороной ножа. Затем подождите около 5 минут перед употреблением. Этот ритуал активирует мощный лечебный аллицин в чесноке.

Чеснок может предотвратить миллионы смертей

Беглое прочтение литературы, предоставленной Национальной медицинской библиотекой, содержащей 4525 отрывков из исследований чеснока, указывает на то, что чеснок играет значительную роль в предотвращении или лечении более 150 заболеваний, от рака до диабета, от инфекций до образования зубного налета. в артериях повреждение ДНК при отравлении ртутью!

Фактически, согласно статистике Всемирной организации здравоохранения, население более бедных стран умирает в основном от причин, непосредственно связанных с инфекционными инфекционными заболеваниями, которые, кстати, не вызваны отсутствием вакцин. , скорее, главным образом из-за недоедания и недоедания. отсутствие санитарии и гигиены, а также неблагоприятные физиологические последствия депрессии и стресса, связанные с бедностью.

Более широкое использование и доступность чеснока могут стать прекрасной альтернативой глобальным инициативам в области вакцинации, использование которых обусловлено не столько убедительными научными исследованиями, сколько политическими и экономическими силами. Чеснок легче приобретать и распространять, и его часто могут выращивать пострадавшие люди или затронутые сообщества, что делает его практически бесплатным.

Чеснок убивает 14 видов рака

Фармацевтическая промышленность потратила миллиарды долларов на исследования «таблетки от рака», но безуспешно.Синтетические лекарства имеют слишком много опасных побочных эффектов, которые становятся высокотоксичными для организма, вызывая больше болезней.

Натуральные и цельные продукты, с другой стороны, содержат полноценные питательные вещества, которые не только останавливают болезни, но и исцеляют организм.

Это удивительное растение может убить как минимум 14 видов рака:

  1. Острый лимфобластный лейкоз
  2. Острый миелоидный лейкоз
  3. Базально-клеточная карцинома
  4. Рак молочной железы
  5. Рак шейки матки
  6. Рак толстой кишки
  7. Рак эндометрия
  8. Рак желудка
  9. Лейкоз: хронический лимфоцитарный лейкоз (ХЛЛ)
  10. Рак печени
  11. Лимфома
  12. Меланома
  13. Остеосаркома
  14. Рак поджелудочной железы

Чеснок защищает сердце

Есть множество способов предотвратить сердечные заболевания и инсульт у чеснока:

  1. Замедляет развитие артериальной бляшки
  2. Благотворно уменьшает белую жировую ткань, увеличивает белую жировую ткань вокруг сердечной мышцы.
  3. Защищает от свертывания
  4. Положительно модулирует липиды крови
  5. Расширяет кровеносные сосуды для улучшения кровообращения
  6. Снижает артериальное давление
  7. Антиоксиданты предотвращают окисление холестерина, вызывающее проблемы с сердцем
  8. Предотвращает нарушение функции расширения артерий
  9. Воспаление сосудов

Чеснок убивает 13 типов инфекций

Согласно исследованиям, чеснок обладает чрезвычайно мощными противоинфекционными свойствами, экспериментально подтверждено, что он убивает:

  1. Золотистый стафилококк, устойчивый к метициллину ( MRSA )
  2. Молочница (разрастание грибка в полости рта)
  3. Pseudomonas Aerigonosima, включая лекарственно-устойчивые штаммы
  4. Цитомегалавирусные инфекции
  5. Афлатоксикоз, ассоциированный с микотоксинами
  6. Инфекция Helicobacter Pylori
  7. Кандидозная (дрожжевая) инфекция
  8. Инфекция Klebseilla
  9. ВИЧ-1 инфекция
  10. Вибрионная инфекция
  11. Mycobacterium Tuberculosis, множественная лекарственная устойчивость
  12. Инфекции, вызванные Clostridium
  13. Вирусные инфекции: простой герпес 1 и 2, вирус парагриппа 3 типа, вирус осповакцины, вирус везикулярного стоматита и риновирус человека 2 типа
  14. Инфекция, вызванная стрептококком группы B

Эти результаты впечатляют, но, вероятно, являются лишь верхушкой айсберга, когда речь идет о способности чеснока убивать раковые клетки и бороться с инфекциями.Нет ни одного обычного антибиотика, который мог бы добиться того же эффекта, что и чеснок, в плане уничтожения вредных микроорганизмов без побочных эффектов. А красота чеснока в том, что он убивает только вредные, не затрагивая полезные микроорганизмы в нашем организме! Что может победить!

Прочтите полный отчет и получите ссылки на исследования здесь: GreenMedInfo.com

Возьмите эту ложку перед сном, чтобы вывести токсины из кишечника и печени во время сна

Перед сном приготовьте это волшебное зелье:

Мелко нарежьте два зубчика свежего чеснока и дайте им постоять на воздухе в течение нескольких минут, пока вы моете блендер или разделочную доску.Измельчение высвобождает фермент аллииназу в чесноке.

Наберите ложкой измельченный чеснок и проглотите его, запивая водой. При желании вы можете добавить немного сырого меда, так как сырой мед является отличным антибактериальным средством. Также можно использовать мед манука, особенно если вы хотите решить проблему с носовыми пазухами или остановить простуду или грипп.

Чеснок и мед пройдут по всему пищеварительному тракту, пока вы спите, очистят и нейтрализуют все токсины, канцерогены, вредные бактерии, грибки, вирусы и чужеродные химические вещества, прежде чем они смогут нанести вред здоровым клеткам.

Соединения серы в чесноке также очищают печень от токсинов крови, свинца и других тяжелых металлов, которые будут выведены на следующий день.

Проглатывание измельченного чеснока не даст вам дыхания чеснока, если вы его не пережевываете.

Утром выпейте большой стакан воды. Ваше первое испражнение будет иметь сильный запах чеснока, и вы узнаете, что вредные вещества были удалены из вашего тела. Попытайся!

Дополнительная информация о чесноке

Полная польза чеснока для здоровья.

Черный чеснок токсичен для 14 видов рака.

Узнайте, как можно вырастить бесконечный запас чеснока в домашних условиях.

Как сделать тазик для аптечки из чеснока.

Как определить, что ваш чеснок из Китая.

Некоторые ссылки, которые я публикую на этом сайте, являются партнерскими. Если вы пройдете через них, чтобы совершить покупку, я получу небольшую комиссию (без дополнительных затрат для вас). Однако обратите внимание, что я рекомендую эти продукты из-за их качества и того, что у меня есть хороший опыт их использования, а не из-за комиссионных.

О Саре Дин

Сара Динг является основателем Juicing-for-Health.com. Она является сертифицированным тренером по здоровью, консультантом по питанию и специалистом по детоксикации. Она помогает занятым мужчинам и женщинам определить первопричину их проблем со здоровьем, чтобы устранить проблемы для оптимального физического / психического здоровья и благополучия.

Подробнее

.

Новый вирус, обнаруженный в комплексе вирусов чеснока, является представителем возможного нового рода семейства Betaflexiviridae (отряд Tymovirales) [PeerJ]

Введение

Чеснок ( Allium sativum L.) - один из наиболее потребляемых овощей в мире, мировое производство которого за трехлетний период (2011–2013 гг.) Составляет более 23 миллионов тонн (Camargo-Filho & Camargo, 2015). Поскольку выращивание чеснока основано на вегетативном размножении, вирусы могут накапливаться после последовательных циклов посадки и распространяться в различных регионах через зараженные луковицы (Conci, Canavelli & Lunello, 2003).На сегодняшний день зарегистрировано множество вирусных заболеваний, некоторые из которых оказывают разрушительное воздействие на развитие чеснока (Conci, Canavelli & Lunello, 2003; Lunello, Di Rienzo & Conci, 2007). Растения чеснока, инфицированные так называемым «вирусным комплексом» (VC), который включает в себя в основном вирусы из родов Potyvirus , Carlavirus и Allexivirus , значительно уменьшили вес и периметр луковицы (Lunello, Rienzo & Conci, 2007).

В этих ВК вирусы чеснока от A до D (GVA, GVB, GVC и GVD), вирус чеснока X (GVX) и вирус мозаики, переносимый чесночным клещом (GMbMV) (Bereda, Paduch-Cichal & Dabrowska, 2017 ; Mituti et al., 2015; Wylie et al., 2014; Ardisson-Araújo et al., 2013). Эти аллексивирусы передаются эриофидными клещами (Kang et al., 2007). Однако, как и большинство вирусов, содержащихся в таких комплексах, их распространение по всему миру обычно связано с транспортировкой луковиц или других частей растений для вегетативного размножения без фитосанитарного контроля. Другими примерами вирусов, часто идентифицируемых в ВК, являются потивирусы, передаваемые тлей, такие как вирус мозаики чеснока (GMV), вирус желтой полосы лука-порея (LYSV) и вирус желтой карликовости лука (OYDV) (Fajardo et al., 2001; Mituti et al., 2015; Wylie et al., 2014) и латентный вирус чеснока (GLV) карлавирусов, общий латентный вирус чеснока (GCLV) и латентный вирус лука-шалота (SLV) (Tsuneyoshi et al., 1998). Помимо этих вирусов с положительными геномами одноцепочечной РНК, вирус желтой пятнистости радужки (IYSV) (семейство Tospoviridade ) привлек внимание к заражению как чеснока, так и лука (Bag et al., 2015). Изоляты IYSV имеют сегментированный негативный геном одноцепочечной РНК и передаются через трипсы (Turina, Kormelink & Resende, 2016).

В этом исследовании мы идентифицировали вирусы, присутствующие в различных сортах чеснока из коллекции зародышевой плазмы EMBRAPA Hortaliças, Бразилия. О большинстве вирусов, обнаруженных в этих образцах, сообщалось ранее, за исключением нового вируса, предположительно классифицированного как член нового рода семейства Betaflexiviridae (заказ Tymovirales ).

Материалы и методы

Образцы чеснока

Восемь сортов чеснока, проанализированных в этом исследовании, являются частью коллекции зародышевой плазмы Бразильской сельскохозяйственной исследовательской корпорации по овощам (EMBRAPA Hortaliças), Бразилия.Эти сорта известны как Branco Mineiro , Cateto Roxo , Amarante , Gigante Lavinia , Moz 2014 Africa , Ito , San Valentin и Chonan . Все они коммерчески выращиваются в Бразилии и делятся на три основные группы (ранние, средние и поздние посадки) в зависимости от климатических требований к луковицеобразным. Температура около 20 ° C, ниже 15 ° C и ниже 10 ° C необходима для надлежащего бульбификации ранних ( Branco Mineiro, и Cateto Roxo ), средних ( Amarante , Gigante Lavinia и млн унций). 2014 Africa ) и поздние ( Ito , San Valentin и Chonan ) сорта чеснока соответственно.Кроме того, во время вегетативного развития у всех этих растений листья имели желтоватую мозаику.

Извлечение РНК, секвенирование и обнаружение ОТ-ПЦР

Суммарную РНК

экстрагировали из симптоматических листьев 10 растений каждого сорта чеснока с использованием набора RNeasy ® Mini (Qiagen, Hilden, Германия) в соответствии с инструкциями производителя. Для высокопроизводительного секвенирования образцы РНК объединяли вместе (пул РНК). Библиотеки кДНК и секвенирование (длина считывания 2 × 100 п.н.) на платформе HiSeq 2000 были выполнены в Macrogen Inc.(Сеул, Республика Корея). Сгенерированные чтения были обрезаны, и de novo собрали с использованием CLC Genome Workbench 6.5.2 (CLC bio, Qiagen). Контиги, относящиеся к вирусам, были получены с помощью Blastx против вирусной базы данных RefSeq. Чтобы определить, соответствуют ли собранные контиги полным вирусным геномам, их сравнивали с полными вирусными геномами, депонированными в общедоступных базах данных с использованием Geneious 7.1.8 (Kearse et al., 2012). Аннотацию генома также выполняли с использованием последней программы, в которой открытые рамки считывания (ORF) были аннотированы с использованием поиска BLASTx по базе данных неизбыточных белков NCBI.

Затем идентифицированные вирусы были отслежены в каждом сорте чеснока с помощью реакции обратной транскриптазы (RT) с последующей амплификацией полимеразной цепной реакции (PCR). Комплементарные последовательности ДНК (кДНК) были синтезированы с использованием обратной транскриптазы SuperScript III (Thermo Fisher Scientific, Waltham, MA, USA) и случайных гексануклеотидов. Затем проводили реакции ПЦР с использованием PCR Master Mix (Promega, Madison, USA) и конкретных пар праймеров для каждого из обнаруженных вирусов (таблица 1).Нуклеотидные (нуклеотидные) последовательности продуктов ПЦР были подтверждены секвенированием по Сэнгеру в Macrogen Inc. Все процедуры следовали инструкциям производителя.

Таблица 1:

Олигонуклеотиды, используемые для амплификации вирусных последовательностей.

Вирус Олигонуклеотиды (от 5 'до 3')
прямой (F) / обратный (R)
Олиго-мишень ORF Размер амплифицированного фрагмента (п.н.)
Вирус чеснока A F- ACATCTTATGCCGCCCTTCT
R- GGTGCGCTAGTCTCATCGTT
Реплика 482
Вирус чеснока B F- ACTTCGCCTACATGCCTGG
R- CCTGTGATTGACGGTGTGGT
Реплика 700
Вирус чеснока C F- CATTTGCGGCGAACAATGGT
R- TTGAGTTTTTGTTCTCTTGAGTTTGTG
Реплика 671
Вирус чеснока D F- TTCCCAGCCTCTTCCCGG
R- ACTTTCATCGTCACTCCAGTC
Реплика 1,064
Вирус чеснока X F- GCCAGAGTTCGCGAGTTCTT
R- CAAAGGTAGTTGACACGCTTGA
Реплика 900
Общий латентный вирус чеснока F- GCATAGTACTTTCTGTCACC
R- TATGCTTCATCCAGAGCTTT
Реплика 975
Латентный вирус чеснока F- TGAAGATTTGGAGGTGGGTTT
R- CGGGTAATAAGCAACGGAGA
Реплика 1,316
Вирус желтого карлика лука F- TCTTTAGTGACGATGCTTTTAAG
R- AGATTTCAGATGCGATTTCACT
ORF полипротеина (белок p1 / белок HC-Pro) 1,170
Вирус желтой полосы лука-порея F- TGTAGTGGTGCGTTTCAGACA
R- TGCTTTCCAATTCGCCCAATG
Белок P1 731
Вирус желтой мозаики чеснока F- GTGTGGCTAGTCTGCTTGGT
R- TTGTGCTTGATCGCGGTTTC
Реплика 1 000
DOI: 10.7717 / peerj.6285 / таблица-1

Филогенетический анализ

Филогенетическое дерево, содержащее распознаваемые ICTV виды семейства Betaflexiviridae , было построено на основе выведенных аминокислотных последовательностей (аа) генов репликазы и белка оболочки (CP). Для деревьев кофилогении использовали последовательности аминокислот репликазы и CP. Множественные выравнивания были выполнены с использованием метода MAFFT (Katoh & Standley, 2013). Затем с помощью PhyML были выведены деревья максимального правдоподобия (ML) (Guindon et al., 2010) в рамках модели замещения JTT (Jones, Taylor & Thornton, 1992). Поддержка ветвей оценивалась с помощью теста Симодаира-Хасегава (Анисимова и др., 2011). Анализ кофилогении между деревьями бетафлексивирусов был выполнен с помощью программы R (R Core Team, 2013) с пакетами Plytools (Schliep, 2018) и Phangom (Schliep, 2018). Наконец, попарные матрицы идентичности были получены с помощью программы SDT (Muhire, Varsani & Martin, 2014) и построены с помощью Evolview (He et al., 2016).

Результаты

Анализ данных HTS выявил наличие вирусов, относящихся к родам Allexivirus (GVA, GVB, GVC, GVD и GVX), Carlavirus (GCLV и GLV) и Potyvirus (OYDV и LYSV). Неожиданно была также обнаружена новая последовательность генома вируса, которая имела близкое родство с вирусами семейства Betaflexiviridae (таблица 2). Каждый из этих вирусов отслеживали в каждом растении (сорте) чеснока с помощью ОТ-ПЦР.Бетафлексивирусоподобный вирус был обнаружен в семи из восьми сортов чеснока. Изоляты GVA и GVB были наиболее частыми вирусами, обнаруженными у всех растений, в то время как изоляты GVC и OYDV были обнаружены только у cv. Gigante Lavinia (Таблица 2).

Таблица 2:

Обнаружение вирусов чеснока в различных бразильских сортах чеснока с помощью ОТ-ПЦР.

Указывается наличие (+) или отсутствие (-) различных вирусов чеснока.
Вирус Культивар
Бранко Минейро Гиганте Ливиния Амаранте Ито Сан-Валентин Cateto Roxo Чонан млн унций 214 Африка
Вирус чеснока A + + + + + + + +
Вирус чеснока B + + + + + + + +
Вирус чеснока C +
Вирус чеснока D + + + + + +
Вирус чеснока X + + + + + + + +
Общий латентный вирус чеснока + + + + + + + +
Латентный вирус чеснока + + +
Вирус желтого карлика лука +
Вирус желтой полосы лука-порея + + + +
Вирус желтой мозаики чеснока + + + + + + +
DOI: 10.7717 / peerj.6285 / таблица-2

Геномная последовательность предполагаемого нового бетафлексивируса была собрана из 3881 чтения. Для этого вируса была получена надежная консенсусная последовательность, поскольку после картирования считывания наблюдалось небольшое количество мутаций. Напротив, мы не смогли получить надежные полные последовательности генома для других вирусов из-за их высокого разнообразия и межвидовой гомологии между собой. Таким образом, только полная последовательность генома нового предполагаемого бетафлексивируса, предварительно названного вирусом желтой мозаики чеснока (GYMaV), была депонирована в базе данных GenBank под регистрационным номером Mh220170 (рис.S1).

GYMaV имеет позитивный смысловой одноцепочечный геном РНК с 8209 нуклеотидами и пятью открытыми рамками считывания, которые кодируют многодоменную репликазу, белки тройного блока генов (TGB1, TGB2 и TGB3) и CP (таблица S1 и рис. S1). . Длина и прогнозируемая молекулярная масса каждого белка показаны в таблице S1. Поскольку последовательности генов CP и репликазы являются критериями для выделения родов в семействе Betaflexiviridae (King et al., 2012), парное сравнение идентичности было выполнено с использованием всех распознаваемых ICTV видов (75 последовательностей) (рис.S2). Репликаза GYMaV имела 56% и 55% идентичности нуклеотидов соответственно с вирусом Т картофеля (номер доступа в GenBank EU835937, род Tepovirus ) и вирусом кольцевой пятнистости африканской масличной пальмы (AY072921, род Robigovirus ). С другой стороны, GYMaV CP имеет 64%, 62% и 61% идентичности нуклеотидов, соответственно, с вирусом хлоротической крапчатости персика (EF693898), вирусом язвы стебля яблони (D21829) и латентным вирусом абрикоса (HQ339956), все члены рода Foveaviru s. Эти значения намного ниже принятого уровня дискриминации видов, равного 72% идентичности как для CP, так и для репликазы (Adams et al., 2012). Даже несмотря на то, что значения идентичности были выше порога идентичности 45% для демаркации рода, GYMaV следует рассматривать как представителя нового рода семейства Betaflexiviridae , как обсуждается далее.

Чтобы сделать вывод об эволюционных взаимоотношениях GYMaV, было построено филогенетическое дерево с белками репликазы (полные последовательности) распознаваемых ICTV видов в семействе Betaflexiviridae (рис. 1). Несмотря на кластеризацию с другими вирусами, GYMaV сформировал независимую и далекую эволюционную ветвь внутри этого семейства.Поскольку для демаркации родов используются последовательности как репликазы, так и гена CP, также был проведен анализ софилогении. GYMaV сгруппировался вместе с представителями рода Robigovirus и неназначенным вирусом легкой мозаики бананов (AF314662) с использованием белков репликазы. Напротив, GYMaV сгруппирован в пределах рода Foveavirus в филогении CP, как предполагают попарные сравнения (фиг. S2 и S3). Более того, деревья были частично неконгруэнтными (рис. 2), в связи с чем возникает вопрос о том, следует ли рассматривать эти два вирусных гена для разграничения родов.

Рисунок 1: Филогенетическое дерево вирусов, относящихся к семейству Betaflexiviridae .

Эти таксоны включают представителей разных родов, кроме вирусов, которые не присвоены или не классифицированы, как показано на NCBI. Это дерево было построено на основе аминокислотных последовательностей репликазы бетафлексивирусов, открытые рамки считывания которых полностью секвенированы.

Рисунок 2: Кофилогения репликазы и CP.

Перечисленные вирусы включают представителей разных родов семейства Betaflexiviridae.Цветные линии указывают на перестройки таксонов для репликазы и ЦП.

Обсуждение

С целью идентификации РНК-вирусов, инфицированных чесноком, на основе непредвзятого подхода была проведена высокопроизводительная секвенирование общей РНК восьми сортов чеснока. В целом были идентифицированы изоляты вируса, таксономически классифицируемые по десяти видам вирусов, девять из которых ранее были зарегистрированы в ВК чеснока (Bereda, Paduch-Cichal & Dabrowska, 2017; Mituti et al., 2015; Wylie et al., 2014). Биологические эффекты этих вирусных инфекций для различных сортов чеснока еще предстоит изучить, но, основываясь на предыдущих исследованиях, они могут поставить под угрозу рост растений и луковиц (Conci, Canavelli & Lunello, 2003; Lunello, Rienzo & Conci, 2007). Хотя все растения представляли собой желтую мозаику, трудно сделать вывод, все ли идентифицированные вирусы связаны с этим симптомом, или существует синергетический эффект среди вирусов в сообществе. В будущих исследованиях эта проблема может быть решена путем биологической изоляции этих вирусов путем механической или трансмиссивной инокуляции / передачи на индикаторные растения или путем конструирования инфекционных клонов кДНК.

Помимо вирусов, ранее сообщавшихся о виромах чеснока, новый бетафлексивирус, предварительно названный вирусом желтой мозаики чеснока (GYMaV), был обнаружен в семи из восьми протестированных сортов чеснока. Присутствие GYMaV в большинстве сортов указывает на то, что он, вероятно, распространился вегетативным путем. Однако нельзя исключать его передачу насекомыми-переносчиками. В настоящее время семейство Betaflexiviridae включает два подсемейства ( Trivirinae и Quinvirinae ), которые вместе включают одиннадцать родов (https: // talk.ictvonline.org/taxonomy/). GYMaV имеет наивысшую идентичность nt с вирусом кольцевой пятнистости африканской масличной пальмы (род Robigovirus ) и вирусом картофеля T (род Tepovirus ) по репликазе (56% и 55% соответственно) и с вирусами, классифицируемыми в роду Foveavirus . для ЦП (идентичность 61–64%). Согласно ICTV, вирусы предполагаемых новых родов должны быть менее чем на 45% идентичны генам с уже зарегистрированными вирусами (King et al., 2012). Однако GYMaV составляет отдаленную эволюционную ветвь Betaflexviridae (рис.1), и поэтому должны быть отнесены к новому роду. Как видно из наших парных матриц идентичности этих генов, отсечение идентичности последовательностей должно быть пересмотрено, так как большинство сравнений для GaYMV превышают порог 45% (рис. S2).

Вирионы

GYMaV могут иметь форму изогнутых филаментов, как это наблюдается у других бетафлексивирусов (King et al., 2012). При типичной геномной организации бетафлексивируса GYMaV кодирует три белка (TGB1, TGB2 и TGB3), вероятно, связанных с межклеточным и системным перемещением вируса в растениях-хозяевах (Erhardt et al., 2005; Морозов, Соловьев, 2003). Как правило, бетафлексивирусы имеют один (30K-подобных) или три белка движения (как GYMaV), что является критерием для отнесения их к подсемействам Trivirinae или Quinvirinae соответственно. Хотя репликаза и гены CP используются для демаркации родов, наш анализ подтверждает концепцию модульной эволюции, показывая, что эти гены и белковые продукты филогенетически несовместимы. Таким образом, для таксономической цели следует использовать либо то, либо другое.Наш анализ также предполагает, что либо GYMaV подвергся рекомбинации, либо эти гены имеют разную частоту мутаций из-за разного давления отбора.

GYMaV как компонент ВК чеснока следует учитывать при разработке безвирусных сортов чеснока. Многие исследования вирусов чеснока, о которых сообщалось ранее, были основаны на целевых методах, поскольку использовались специальные инструменты обнаружения (Chen & Adams, 2001; Chen, Chen & Adams, 2002; Fajardo et al., 2001; Fayad-Andre, Dusi & Resende, 2011; Нам и др., 2015; Taglienti et al., 2018). Хотя это первый отчет GYMaV, мы не можем исключить его присутствие в более широком географическом и временном масштабе.

Выводы

GYMaV - это предполагаемый новый бетафлексивирус, обнаруженный в вирусных комплексах нескольких сортов чеснока. Основываясь на высокой частоте встречаемости в этих растениях, GYMaV, вероятно, будет размножаться вегетативно, как и другие вирусы, о которых ранее сообщалось в таких комплексах. Хотя гены репликазы и CP используются в качестве таксономических критериев для определения родов семейства Betaflexiviridae , анализ кофилогении показал, что эти гены по-разному сортируют бетафлексивирусы.

Дополнительная информация

Геномная организация и нуклеотидная последовательность GYMaV

Сокращения: белок тройного генного блока (TGB), белок движения (MP) и белок оболочки (CP).

DOI: 10.7717 / peerj.6285 / supp-1

Попарные алигаты идентичности генов / белков CP и репликазы из бетафлексивирусов

Числа указывают процент идентичных нуклеотидов или аминокислот при попарном выравнивании.

DOI: 10.7717 / peerj.6285 / supp-2

CP Филогенетическое дерево вирусов, отнесенных к семейству Betaflexiviridae

Таксоны включали признанные CTV виды разных родов, за исключением вирусов, которые не присвоены или не классифицированы, как показано на NCBI. Это дерево было построено на основе предсказанных CP аминокислотных последовательностей бетафлексивирусов, открытые рамки считывания которых полностью секвенированы.

DOI: 10.7717 / peerj.6285 / супп-3

Подтверждение подачи таксономического предложения новой последовательности вируса растений в ICTV

Электронные сообщения, касающиеся подачи таксономического предложения о новой последовательности генома вируса растений в ICTV.

DOI: 10.7717 / peerj.6285 / supp-4 .

Сырой чеснок от простуды и гриппа: исследования и против

С детства вы, наверное, слышали, что чеснок полезен при простуде и боли в горле. Мы все слышали это раньше, возможно, даже когда-то делились тем же советом.

Но помимо того факта, что вы могли слышать это от своей мамы или друга ... знаете ли вы какие-либо доказательства, подтверждающие это предполагаемое средство?

Миф, мошенничество или законное лечение?

Прежде чем мы углубимся в клинические исследования на людях, посвященные профилактике и лечению простуды, давайте рассмотрим предполагаемые причины, по которым, как говорят, помогают чесночные средства.

Некоторые из них действительно имеют научную основу, предполагающую, что может быть действительным. Остальные либо полностью сфабрикованы, либо являются большим преувеличением.

1-я претензия: чеснок от коронавируса

В свете вспышки коронавируса в Ухане в 2020 году некоторые утверждают, что чеснок полезен для борьбы с коронавирусом (COVID-19).

Давай пощекочу эту по заднице прямо сейчас…

Заключение: неверно

Практически отсутствуют научные исследования чеснока и коронавируса человека COVID-19, который является новой формой вируса.Коронавирусы - это широкая категория вирусов, и любые исследования чеснока, связанные с другими формами, полностью отличаются от COVID-19.

Например, после риновируса, который вызывает 30-80% случаев простуды, коронавирусы человека являются второй или третьей по частоте причиной. По оценкам, они вызывают 15% простудных заболеваний. Однако это не то же самое, что форма COVID-19, пришедшая из Китая. (19) (20)

На PubMed есть только одна медицинская литература, в которой экстракт чеснока используется для профилактики или лечения коронавируса.Это были куриные яйца.

В лаборатории куриным эмбрионам (яйцам) был введен вирус инфекционного бронхита (ИБК), который является разновидностью коронавируса. В заключении говорилось: «Экстракт чеснока оказывает ингибирующее действие на ИБК у куриных эмбрионов». На приведенном выше графике это показано. (21)

Но это нечто совершенно иное, чем человеческие формы, не говоря уже о новом COVID-19.

Люди, которые утверждают, что чеснок лечит коронавирус, распространяют опасную ложь. Его НЕ следует использовать при каких-либо инфекциях или болезнях в этом отношении.

Совершенно не связанные с инфекциями и иммунитетом, возможно, лучшее исследование добавок чеснока связано с поддерживающими его преимуществами для сердечно-сосудистой системы, но это не доказано.

2-я претензия: природный антибиотик

Многие сайты, посвященные питанию, утверждают, что вам следует жевать зубчик чеснока, чтобы предотвратить простуду. Некоторые даже утверждают, что как природный антибиотик он действует аналогично Ципро и другим рецептам от инфекций носовых пазух.

Они утверждают, что от простуды следует использовать только свежий чеснок, а не приготовленный или обработанный порошок.

Почему? Потому что, когда вы раздавливаете свежий зубчик чеснока, происходит химическая реакция, в результате которой выделяется аллицин, который обладает якобы антибиотическими свойствами. После нагревания или по прошествии времени аллицин разрушается.

Некоторые источники рекомендуют сразу жевать чеснок, в то время как другие говорят, что его следует раздавить и оставить на 15 минут, пока происходит ферментативная активность для образования аллицина.

Заключение: неверно и не имеет отношения к делу

В нашем обзоре природных антибиотиков мы рассмотрели все исследования чеснока.

Большинство исследований - и их всего несколько - касались инфекций, вызванных H. pylori, E. coli и Staphylococcus aureus (также известные как стафилококковые инфекции).

Обладает ли чеснок антимикробными свойствами? Да, похоже, но его эффективность кажется слабой по сравнению с лекарством , и некоторые исследования пришли к выводу, что на самом деле антимикробного эффекта нет.

В тех исследованиях, которые подтвердили, что чеснок является природным антибиотиком, они очень ясно показали, что он не заменит лечения по рецепту (1):

«не обладает сильным действием, как антибиотик Импинем»

Импинем - это антибиотик типа IV. Даже если чеснок действительно работает, бактерии могут вызывать только инфекции носовых пазух и некоторые боли в горле.

Грипп и простуда вызываются вирусами , которые не являются бактериями. Даже сильнодействующие антибиотики, отпускаемые по рецепту, не будут иметь никакого эффекта против риновируса, который является наиболее распространенным типом вируса, вызывающим простуду (2).

3-я претензия: Противовирусный

Действительно, многие вещи могут помочь успокоить и временно облегчить побочные эффекты простуды, такие как насморк или першение в горле. Но что касается устранения основной причины - вируса - что-то должно обладать антивирусной активностью, чтобы даже иметь шанс быть полезным.

Чтобы не было путаницы, Ничего из существующего сегодня не было доказано как лекарство от простуды .

Лекарств, отпускаемых по рецепту, не существует. Так называемые лечебные средства на травах, которые продаются без рецепта, такие как Sambucol черная бузина, имеют за собой некоторые интересные исследования, но они остаются недоказанными.

Для лечения гриппа существуют пероральные противовирусные препараты Тамифлю (осельтамивир) и Реленза (занамивир). Рапиваб (перамивир) аналогичен, но редко используется вне больниц, поскольку вводится внутривенно (3). Это единственные лекарства от гриппа, одобренные FDA и подтвержденные медициной .

Однако одним из основных недостатков является то, что Тамифлю может быть неэффективным против гриппа, как и аналогичные лекарства (так называемые адамантаны).

Также для того, чтобы заработать, лечение должно начинаться в начале заражения гриппом.Есть побочные эффекты, которые также необходимо взвесить в сравнении с потенциальной пользой.

Но даже при ранней диагностике и лечении существуют вирусы гриппа, устойчивые к Тамифлю. Например, грипп A типа h4N2 и h2N1 2009 устойчивы к адамантанам (4).

Хотя эти лекарства действительно работают против подавляющего большинства штаммов, их эффективность обсуждается. Кокрановская база данных систематических обзоров собрала результаты 46 клинических испытаний (20 для осельтамивира и 26 для занамивира) и сказала:

«Мы обнаружили, что оба препарата сокращают продолжительность симптомов гриппоподобного заболевания (неподтвержденный грипп или« грипп ») менее чем на день .Осельтамивир не повлиял на количество госпитализаций, по данным… »

Лучше сбриться менее чем за день, чем ничего не улучшить, но вряд ли это впечатляет.

Кокрейн заявил, что их результаты согласуются с другими консервативными выводами, такими как слово «скромный» , используемое FDA для описания общей эффективности лекарств (5) (6).

Проблемы, подобные этим, почему есть (7):

«… постоянная потребность в новой противогриппозной терапии с использованием новых целей и творческих стратегий.”

Несмотря на то, что потребность существует, это не означает, что люди должны быть оптимистичны по поводу того, что чесночные препараты могут быть разработаны, чтобы заполнить эту пустоту, на основе сегодняшних исследований.

Заключение: недостаточно доказательств

Есть исследования, которые предполагают, что противовирусные свойства чеснока могут существовать, но доказательства ограничены и в основном сводятся к лабораторным экспериментам с использованием вирусов в чашке Петри или аналогичных.

Например, в исследованиях было обнаружено, что экстракт оказывает противовирусное действие на цитомегаловирус (ЦМВ) (8).Исследование, проведенное в 2016 году, показало, что он оказывает ингибирующее действие на вирус инфекционного бронхита (IBV) у куриных эмбрионов (9). Мы не видели ничего о борьбе с гриппом в чашке Петри.

Интересно, но подобные исследования ничего не говорят нам о том, могут ли они помочь предотвратить распространение вирусов в организме человека. Мы даже не знаем, помогает ли чеснок собакам, кошкам или другим домашним животным. В этих экспериментах использовались пробирки или аналогичные методы, а не на живых и дышащих животных.

4-я претензия: противоотечное и отхаркивающее

Говорят, что сырой чеснок является естественным отхаркивающим средством при заложенности грудной клетки, так как он помогает разжижить слизь в горле, чтобы вы могли ее откашлять.

Как использовать чеснок в качестве противозастойного средства при насморке довольно просто. Инструкции по домашнему средству обычно включают очистку пары сырых гвоздик и тщательное пережевывание по одной в течение нескольких минут. Проглотите, а затем повторите с другой гвоздикой.

Не рекомендуется делать это натощак. Известно, что сырые гвоздики вызывают изжогу, поэтому некоторым людям это не рекомендуется, особенно перед сном!

Для жевания некоторые рекомендуют сначала размять и смешать с лимонным соком или яблочным уксусом.Проблема в том, что обе эти жидкости очень кислые, и может необратимо повредить эмаль ваших зубов. , если они недостаточно разбавлены.

Многие добавляют мед, чтобы сделать вкус более приятным, что кажется более безопасным вариантом по сравнению с ACV или лимоном.

Вывод: может помочь

Из 3 претензий это кажется наиболее правдоподобным.

Даже не глядя на клинические исследования, вы знаете то чувство, которое испытываете, когда надкусываете сырой чеснок.Сильный острый вкус может мгновенно вызвать реакцию носовых пазух, вызывающую насморк или приступ чихания.

Обычно этот побочный эффект нежелателен, но когда вы заболели простудой, вам нужно избавиться от сильной заложенности носа. Вы хотите, чтобы у вас не было чихания и вы могли чихать!

Псевдоэфедрин отлично подходит для этого, но он также может вызывать у некоторых неприятные побочные эффекты, такие как учащенное сердцебиение, головокружение и беспокойство.

Из-за сердечных заболеваний некоторые люди не могут принимать лекарства, отпускаемые без рецепта, даже при желании.Таким образом, естественное средство от этого симптома пользуется широкой популярностью не только у органических и натуропатических людей.

Как чеснок помогает при простуде, действуя как противозастойное средство? Вы не можете назвать это проверенным средством или лечением, но, по данным Центра восточно-западной медицины Калифорнийского университета в Лос-Анджелесе, это природные соединения аллицин, S-аллицистеин и аджоен (10). Считается, что они помогают оттекать слизь в носовых пазухах и обладают противовоспалительным действием.

Даже если он помогает при заложенности носа, имейте в виду, что он лечит только симптомы простуды или гриппа.Он ничего не делает для борьбы с основной причиной - вирусом. Или в случае инфекции носовых пазух - бактерии.

В качестве недоказанных лечебных трав, белый и черный чеснок, а также лук используются для облегчения застойных явлений в груди. Измельчение сырых гвоздик и смешивание их с кипящей водой для создания парового ингалятора - одна из распространенных практик.

Некоторые любят вдыхать пар, заваривая чесночный чай от ангины, вызываемой стрептококковыми бактериями.

Будь то вирус, бактерия, астма или аллергия, вызывающие боль в горле с заложенностью, многим людям помогает простой пар от душа. Так что неизвестно, что именно - если вообще что - делает добавление чеснока в пар, поскольку не было проведено исследований для сравнения и сравнения.

Что говорят клинические исследования

Итак, вы вкратце узнали о 3 основных причинах, по которым люди торгуют этой травой.

Теперь давайте посмотрим, как они соотносятся с клиническими исследованиями на людях при простуде и других респираторных инфекциях.

PubMed, правительственная база данных, содержащая десятки миллионов ссылок на медицинскую литературу, - это место, где будут перечислены все законные исследования.

Поиск по Allium sativum (научное название чеснока) дает более 6600 результатов, из которых 248 являются клиническими испытаниями .

Если отфильтровать эти на наличие слова «холодный», вы получите только 7 результатов . Некоторые из них даже не актуальны, поскольку они упоминают слово «холодный» в другом контексте.

Вместо того, чтобы выбирать, какое из них цитировать, наиболее справедливый и сбалансированный способ - это взглянуть на все исследования в целом . Это делает метаанализ. Он рассматривает несколько прошлых исследований и вместе анализирует результаты.

2007 метаанализ

Каково было мнение десять лет назад?

британских исследователей изучили все прошедшие клинические испытания. Не только исследования чеснока при простуде, но и исследования, в которых используется трава для лечения других заболеваний.Их вывод был (11):

«Поиск в литературе выявил шесть соответствующих систематических обзоров, метаанализов и двойных слепых рандомизированных исследований (РКИ), которые были опубликованы впоследствии. Они связаны с раком, простудой, гиперхолестеринемией, гипертонией, заболеванием периферических артерий и преэклампсией. Доказательства, основанные на тщательных клинических испытаниях чеснока, неубедительны ».

На основании исследований, проведенных до этого момента, они в основном исключили пользу для снижения артериального давления и высокого уровня холестерина.Для всех других состояний, включая простуду, они сказали:

«… недостаточно данных для клинических рекомендаций».

Таким образом, слова «неубедительно» не кажутся полностью исключенными для лечения простуды с чесноком, скорее, клинических данных по этому поводу недостаточно.

2014 метаанализ

Для метаанализа нет никого лучше, чем Кокрановская база данных систематических обзоров. Они специализируются на этом.

В отношении чеснока и простуды Кокрейн провел метаанализ в 2009 году, затем снова в 2012 году, и последнее обновление его было в 2014 году (12) (13) (14).

На момент последнего обзора было 8 исследований, но из них только одно квалифицировало как объективное и прошедшее научную проверку для рассмотрения.

Это исследование было проведено Университетом Флориды и опубликовано в 2012 году в уважаемом журнале Clinical Nutrition (15). Он также был зарегистрирован в ClinicalTrials.gov, то, что большинство не выдержит (16).

Исследование Университета Флориды

Вместо того, чтобы просто смотреть на простуду, они объединили эту болезнь с гриппом. С точки зрения того, как часто люди болеют и как долго они болеют, оба этих заболевания были объединены в результаты.

  • рандомизированное, двойное слепое и плацебо-контролируемое
  • Набрано
  • 120 здоровых добровольцев
  • 60 получили инкапсулированный экстракт выдержанного чеснока (доза равна 180 мг аллицина в день)
  • 60 получили версию плацебо для ежедневного приема
  • Обе группы принимали их в течение 12 недель

Также были учтены переменные, которые могут повлиять на результат, например, кто сделал прививку от гриппа, личную гигиену и демографические данные (возраст и пол).Люди с хроническим заболеванием, беременные или кормящие грудью, страдающие ожирением (ИМТ выше 30) или имеющие высокое кровяное давление (140/90 или выше) не имели права участвовать.

Результаты?

В группе, принимавшей чесночные добавки, было 24 случая простуды или гриппа. В группе плацебо это было 65 случаев. Это означает, что у тех, кто принимал чеснок, было на 60% меньше случаев простуды или гриппа .

При сложении продолжительности болезни людей общее количество дней составило:

  • 111 дней болезни для группы приема добавок чеснока
  • 366 больничных дней для группы плацебо

Это почти на 70% меньше больничных для тех, кто принимает чеснок .Насколько долго длилось выздоровление во время каждого приступа болезни:

  • 4,63 дня болезни по чесноку
  • 5,63 дня болезни для плацебо

Хотя это интересно слышать, важно помнить, что это было всего лишь одно исследование. Вот почему Кокрановская база данных пришла к выводу:

«Недостаточно доказательств клинических испытаний, касающихся воздействия чеснока на профилактику или лечение простуды. Одно исследование показало, что чеснок может предотвратить простуду, но необходимы дополнительные исследования, чтобы подтвердить этот вывод.”

Это последнее клиническое исследование по этой теме, поэтому даже сегодня этот ответ остается прежним .

Чеснок от гриппа еще менее изучен, и это, кажется, единственное авторитетное исследование. Однако нельзя экстраполировать результаты и попытаться применить их к вирусам гриппа A (h2N1) или (h4N2), вирусам гриппа B или птичьему гриппу (H5N1). Точная разбивка случаев гриппа и простуды в исследовании даже не ясна, не говоря уже о том, какой тип вируса гриппа был у каждого человека.

В 2016 году автор из Университета Флориды опубликовал исследовательскую работу, в которой суммировал теоретические преимущества того, почему чеснок может помочь иммунной системе (17).

Названный «Выдержанный экстракт чеснока изменяет иммунитет человека». он был опубликован в The Journal of Nutrition , который, возможно, является самым престижным рецензируемым медицинским журналом в этой области.

Научная теория, хотя и не доказанная, состоит в том, что экстракт чеснока положительно влияет на γδ-T и естественные киллеры (NK) в организме.Это потому, что они обнаружили более высокую активацию этих клеток в группе чеснока по сравнению с теми, которые принимали плацебо в испытании. Автор сказал:

«… иммунная система хорошо работает с добавкой AGE [выдержанный экстракт чеснока], возможно, с меньшим сопутствующим воспалением».

На графиках слева направо показаны пролиферация γδ-Т-клеток, сывороточные уровни S-аллилцистеина (SAC) и уровни глутатиона (GSH). На всех трех диаграммах ВОЗРАСТ = группа капсул с выдержанным экстрактом чеснока.

Борьба с гриппом с помощью чеснока?

Как уже упоминалось, отдельных клинических исследований не существует, и даже если вы расширите свой поиск до всего на PubMed, содержащего слова «Allium sativum» и «грипп» или «грипп», вы почти останетесь с пустыми руками.

Если быть точным, то семь результатов. Из них мы уже обращались к большинству из них, или в их текстах грипп упоминается лишь мимоходом, не связанным с этим вопросом.

Единственное, что кажется актуальным, было опубликовано в 2016 году исследователями из Индии (18):

«… для предотвращения или лечения вирусной инфекции необходимо определить новые ингибиторы против NA [нейраминидазы].Подходы in silico docking, использованные в этом исследовании, выявили молекулярное взаимодействие природных лигандов с белком NA, что может представлять интерес при разработке новых лекарств из природных источников против h2N1 ».

Говоря простым языком , они говорят, что Тамифлю (озельтамивир) действует, подавляя НА вирусов гриппа

NA - это тип белка, который «в основном отвечает за инициирование вирусной инфекции и необходим для жизненного цикла h2N1.”

Итак, если вы можете подавить этот белок в вирусе, вы можете предотвратить или лечить грипп.

В своих лабораторных исследованиях они рассмотрели 13 активных растительных соединений , которые, по их мнению, могут ингибировать NA, по крайней мере, в некоторой степени.

Аллицин является биосинтетическим предшественником аджоена.

Этими изолированными соединениями и источниками, которые они использовали для них, были:

  • аллицин - имбирь (в измельченном сыром чесноке фермент аллииназа превращает аллиин в аллицин)
  • аджоэн - чеснок
  • андрографолид - калмег
  • байкалин - scutellaria galericulata
  • карвакрол - ajwain
  • эвгенол - тулси
  • ментол - манта
  • теафлавин - зеленый чай
  • катехин - зеленый чай
  • курмарен - лакричник
  • урсолик - тулси
  • куркумин - куркума
  • тиноспорон - гилой

В своих лабораторных экспериментах по стыковке молекул исследователи заявили:

«Сообщалось, что все природные лиганды [13 соединений, перечисленных выше] блокируют инфекцию гриппа; наше исследование стыковки также выявило in silico подтверждение возможного механизма блокировки.Было обнаружено, что большинство природных лигандов взаимодействуют с белком NA h2N1 с эффективной энергией связывания… »

Но помните, это лабораторный эксперимент. То, что что-то работает в пробирке, не обязательно означает, что то же самое произойдет и с человеческим телом со всеми другими биологическими процессами.

Несмотря на то, что это исследование проводилось почти 2 года назад, ничего нового по этой теме не опубликовано.

На вынос

Борется ли чеснок с инфекцией и убивает ли организм вирусы? Любой веб-сайт, утверждающий, что чеснок лечит простуду, помогает от гриппа или борется с коронавирусом, полностью преувеличивает и приукрашивает исследования. Откровенно говоря, лжецы .

Мы прошли исследования и, как видите, действительно не так много. Нет доказательств того, что чеснок полезен при простуде, кашле или гриппе. .

Да, лабораторный эксперимент показал, что он может быть эффективным против белка нейраминидазы вируса гриппа , но никто не знает, будет ли он действовать так же в организме человека .

На сегодняшний день единственное, что можно честно заявить, - это то, что жевание или употребление сырых гвоздик может улучшить заложенность носа и груди, но только за счет разжижения слизи.

Это временное лечение симптома или побочного эффекта инфекции. Он не борется с самим вирусом или бактериями, которые за него ответственны.

Возможно ли, что в будущем, после проведения большего числа клинических испытаний, аджоен и / или аллицин будут признаны полезными? Конечно, все возможно. Но прямо сейчас нет достаточных исследований, подтверждающих заявления некоторых людей о профилактике, лечении или лечении.

Если - и мы подчеркиваем слово , если - будущие исследования обнаружат, что использование чеснока при заболевании полезно, оно, скорее всего, не будет связано с типичными источниками пищи .

Да, было бы абсолютным удовольствием назначить диету из чесночного хлеба в качестве лечения простуды, но этого никогда не произойдет.

Почему? Поскольку соединение аллицина создается ферментом при измельчении сырого гвоздики. Вскоре после этого он уничтожается, даже если он еще сырой. Тепло мгновенно его разрушает.

Это означает, что приготовленные продукты, содержащие эту специю, не будут содержать аллицина . Этот факт также отменяет идею использования чесночного чая с медом, поскольку кипящая вода разрушит любой присутствующий аллицин.

Даже если это сработает, можно только догадываться, сколько чеснока употреблять во время болезни. Это клиническое испытание включало дозу «экстракта выдержанного чеснока», который принимали в виде капсул с добавкой 4 раза в день.

Это соответствует 180 мг суточной дозы стабилизированного аллицина , согласно комментарию Кокрановской базы данных. Преобразовать это в количество свежего чеснока, которое нужно жевать или съесть, будет сложно, учитывая нестабильность, когда он свежий, из-за быстрого ухудшения ферментативной реакции.

Так что не только неизвестно, работает ли он вообще, но и с проверкой только одной дозировки никто даже не знает, как сравниваются другие количества, не говоря уже о жевании или проглатывании зубчиков чеснока в холодном виде.

Возвращаясь к теме коронавируса COVID-19, чтобы быть кристально ясным и повторить, НИКАКИХ исследований или доказательств того, что это помогает, не проводилось. НЕ используйте свежий чеснок или добавки для лечения, лечения или предотвращения этого вируса или любого другого вируса.

Эти утверждения не были проверены Управлением по контролю за продуктами и лекарствами.Этот продукт не предназначен для диагностики, лечения или предотвращения каких-либо заболеваний.

.

Смотрите также